Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07046

HP ID(1) HP07046
Gene ID(2) 7182
Gene Symbol finder NR2C2
Protein Name nuclear receptor subfamily 2, group C, member 2
RefSeq NM_003298.3
Length of RefSeq (bp) 8330
Chromosome 3p25
Reference DDBJ accession
UniGene Hs.555973

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi80D02 pGCAP10 CGGCCGGCGCCTGGTCTTGGGTCAGCAGGTGGGCTGCTTCCCTCCGCCTGGAACGCGTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl