Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NR2C2

Gene ID (NCBI) 7182
Gene Symbol NR2C2
Protein Name nuclear receptor subfamily 2, group C, member 2
Synonyms TAK1|TR2R1|TR4|hTAK1
Databases KEGG link 01 |  NCBI Gene link 01


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06114 pCMFlag_hsTR4 Expression vector of human TR4
RDB06115 pCMFlag_hsTR4 variant Expression vector of human TR4 variant hTAK1

RDB_hum_160722.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX006052 IRAK015C04 pCMV-SPORT6 BC030715 NM_003298 Partial/var
HGY036483 IRAK091D11 pBluescript BC051670 NM_003298 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR192074 ARi80D02 pGCAP10 NM_003298.3
CGGCCGGCGCCTGGTCTTGGGTCAGCAGGTGGGCTGCTTCCCTCCGCCTGGAACGCGTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl