Prev. |  KEGG KO K08544 > 

RIKEN DNA Bank Human Resource - NR2C2

Gene ID NCBI Gene 7182 |  KEGG hsa:7182
Gene Symbol NR2C2
Protein Name nuclear receptor subfamily 2 group C member 2
Synonyms TAK1|TR4
Ortholog resource in our bank

  NR2C2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06114 pCMFlag_hsTR4 Expression vector of human TR4.
RDB06115 pCMFlag_hsTR4 variant Expression vector of human TR4 variant hTAK1.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006052 IRAK015C04 pCMV-SPORT6 BC030715 NM_003298 Partial/var
HGY036483 IRAK091D11 pBluescript BC051670 NM_003298 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR192074 ARi80D02 pGCAP10 NM_003298.3  
CGGCCGGCGCCTGGTCTTGGGTCAGCAGGTGGGCTGCTTCCCTCCGCCTGGAACGCGTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl