Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07039

HP ID(1) HP07039
Gene ID(2) 55707
Gene Symbol finder NECAP2
Protein Name NECAP endocytosis associated 2
RefSeq NM_018090.4
Length of RefSeq (bp) 2092
Chromosome 1p36.13
Reference DDBJ accession
UniGene Hs.437385

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi79F12 pGCAP10 GGGTGGGCTCCAGGCGTCGCGATGGAGGAGAGCGGGTACGAGTCGGTGCTCTGTGTCAAG
RBdS015M14 pGCAP10 GGGAAGTCGCCGGAAGTTCGGTGGGCTCCAGGCGTCGCGATGGAGGAGAGCGGGTACGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl