Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NECAP2

Gene ID (NCBI) 55707
Gene Symbol NECAP2
Protein Name NECAP endocytosis associated 2
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K20069)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008221 IRAK020J05 pCMV-SPORT6 BC017014 NM_018090 Full
HGY087107 IRAL017M19 pOTB7 BC018914 NM_018090

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR191732 ARi79F12 pGCAP10 NM_018090.4  
GGGTGGGCTCCAGGCGTCGCGATGGAGGAGAGCGGGTACGAGTCGGTGCTCTGTGTCAAG
HKR406302 RBdS015M14 pGCAP10 NM_018090.4  
GGGAAGTCGCCGGAAGTTCGGTGGGCTCCAGGCGTCGCGATGGAGGAGAGCGGGTACGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl