Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07014

HP ID(1) HP07014
Gene ID(2) 5356
Gene Symbol finder PLRG1
Protein Name pleiotropic regulator 1 (PRL1 homolog, Arabidopsis)
RefSeq NM_002669.2
Length of RefSeq (bp) 1797
Chromosome 4q31.2-q32.1
Reference DDBJ accession
UniGene Hs.249996

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi01A02 pGCAP10 GGGAAGGTGCTGCACAGCTGTGGCGGCGGGTACTGCGTTAGTGATTAGAGTTTCTTCCCT
ARi01B11 pGCAP10 GGGAAGGTGCTGCACAGCTGTGGCGGCGGGTACTGCGTTAGTGATTAGAGTTTCTTCCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl