Prev. |  KEGG KO K12862 > 

RIKEN DNA Bank Human Resource - PLRG1

Gene ID NCBI Gene 5356 |  KEGG hsa:5356
Gene Symbol PLRG1
Protein Name pleiotropic regulator 1
Synonyms Cwc1|PRL1|PRP46|PRPF46|TANGO4
Ortholog resource in our bank

  PLRG1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04427 SEREX clone BRC-Co-23 #1 SEREX clone BRC-Co-23 #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY095172 IRAL037P12 pDNR-LIB BC020786 NM_002669 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022546 W01A056G02 pENTR-TOPO flj0038i01 AK002108 NM_002669  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR160402 ARi01A02 pGCAP10 NM_002669.2  
GGGAAGGTGCTGCACAGCTGTGGCGGCGGGTACTGCGTTAGTGATTAGAGTTTCTTCCCT
HKR160435 ARi01B11 pGCAP10 NM_002669.2  
GGGAAGGTGCTGCACAGCTGTGGCGGCGGGTACTGCGTTAGTGATTAGAGTTTCTTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl