Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07011

HP ID(1) HP07011
Gene ID(2) 90933
Gene Symbol finder TRIM41
Protein Name tripartite motif-containing 41
RefSeq NM_033549.3
Length of RefSeq (bp) 3641
Chromosome 5q35.3
Reference DDBJ accession
UniGene Hs.441488

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi76D08 pGCAP10 GAGGCCGGAAGCTAGGGGCGGGGCCAGGAAGTGAGGAGGGGCGGGGGTTTATGAGGAGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl