Prev. |  KEGG KO K12017 > 

RIKEN DNA Bank Human Resource - TRIM41

Gene ID NCBI Gene 90933 |  KEGG hsa:90933
Gene Symbol TRIM41
Protein Name tripartite motif containing 41
Synonyms RINCK
Ortholog resource in our bank

  TRIM41

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085492 IRAL013M04 pOTB7 BC004956 NM_201627 Partial/var
HGY096023 IRAL040A23 pOTB7 BC018765 NM_201627 Partial
HGY103222 IRAL058A22 pOTB7 BC071887 NM_201627 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR190480 ARi76D08 pGCAP10 NM_033549.3  
GAGGCCGGAAGCTAGGGGCGGGGCCAGGAAGTGAGGAGGGGCGGGGGTTTATGAGGAGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl