Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06995

HP ID(1) HP06995
Gene ID(2) 23239
Gene Symbol finder PHLPP1
Protein Name PH domain and leucine rich repeat protein phosphatase 1
RefSeq NM_194449.1
Length of RefSeq (bp) 4798
Chromosome 18q21.33
Reference DDBJ accession
UniGene Hs.465337

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi74E09 pGCAP10 GGCCATTGGCTTCTCCCTTCTCCGCGCGCCGCCGCCGTCTCCCACCTCCGCCTCATCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl