Prev. |  KEGG KO K16340 > 

RIKEN DNA Bank Human Resource - PHLPP1

Gene ID NCBI Gene 23239 |  KEGG hsa:23239
Gene Symbol PHLPP1
Protein Name PH domain and leucine rich repeat protein phosphatase 1
Synonyms PHLPP|PLEKHE1|PPM3A|SCOP
Ortholog resources KEGG ortholog (KEGG orthology K16340) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006251 IRAK015K11 pCMV-SPORT6 BC014927 NM_194449 Full
HGX005560 IRAK013O24 pCMV-SPORT6 BC010706 NM_194449 Partial
HGY036299 IRAK090M11 pBluescript BC047653 NM_194449 Partial/var
HGY103691 IRAL059D19 pOTB7 BC082244 NM_194449 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR189705 ARi74E09 pGCAP10 NM_194449.1  
GGCCATTGGCTTCTCCCTTCTCCGCGCGCCGCCGCCGTCTCCCACCTCCGCCTCATCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl