Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06969

HP ID(1) HP06969
Gene ID(2) 54496
Gene Symbol finder PRMT7
Protein Name protein arginine methyltransferase 7
RefSeq NM_019023.1
Length of RefSeq (bp) 2390
Chromosome 16q22.1
Reference DDBJ accession
UniGene Hs.712584

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi55F10 pGCAP10 GGTGCTGGCCGCGGTAAAAGTGGTAGCAGCGGAGGCGAGCGGAGGGTTTCCCGCGGCGGA
RBd09F03 pGCAP10 GGGTAAAAGTGGTAGCAGCGGAGGCGAGCGGAGGGTTTCCCGCGGCGGATTTCTGACAGT
RBd36H04 pGCAP10 GGCTGCGAGGTCCCGCCCCGCGTGCTGGCCGCGGTAAAAGTGGTAGCAGCGGAGGCGAGC
RBd72B10 pGCAP10 GGTAGCAGCGGAGGCGAGCGGAGGGTTTCCCGCGGCGGATTTCTGACAGTCAGACTTGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl