Prev. |  KEGG KO K11438 > 

RIKEN DNA Bank Human Resource - PRMT7

Gene ID NCBI Gene 54496 |  KEGG hsa:54496
Gene Symbol PRMT7
Protein Name protein arginine methyltransferase 7
Synonyms SBIDDS
Ortholog resource in our bank

  PRMT7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001555 IRAK003O19 pCMV-SPORT6 BC000146 NM_019023 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182130 ARi55F10 pGCAP10 NM_019023.1  
GGTGCTGGCCGCGGTAAAAGTGGTAGCAGCGGAGGCGAGCGGAGGGTTTCCCGCGGCGGA
HKR363723 RBd09F03 pGCAP10 NM_019023.1  
GGGTAAAAGTGGTAGCAGCGGAGGCGAGCGGAGGGTTTCCCGCGGCGGATTTCTGACAGT
HKR374572 RBd36H04 pGCAP10 NM_019023.1  
GGCTGCGAGGTCCCGCCCCGCGTGCTGGCCGCGGTAAAAGTGGTAGCAGCGGAGGCGAGC
HKR388834 RBd72B10 pGCAP10 NM_019023.1  
GGTAGCAGCGGAGGCGAGCGGAGGGTTTCCCGCGGCGGATTTCTGACAGTCAGACTTGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl