Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06962

HP ID(1) HP06962
Gene ID(2) 28987
Gene Symbol finder NOB1
Protein Name NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)
RefSeq NM_014062.1
Length of RefSeq (bp) 1733
Chromosome 16q22.3
Reference DDBJ accession
UniGene Hs.271695

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd09D01 pGCAP10 GACGCAGCCAACATGGCTCCAGTGGAGCACGTTGTGGCGGATGCTGGGGCTTTCCTGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl