Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06954

HP ID(1) HP06954
Gene ID(2) 9344
Gene Symbol finder TAOK2
Protein Name TAO kinase 2
RefSeq NM_004783.2
Length of RefSeq (bp) 4625
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.291623

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd08E06 pGCAP10 GAGGGAGACCGGGACGAGACCGGGGCTGTGGTGCGGAGAGAGGCTGAGACGGAGAAGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl