Prev. |  KEGG KO K04429 > 

RIKEN DNA Bank Human Resource - TAOK2

Gene ID NCBI Gene 9344 |  KEGG hsa:9344
Gene Symbol TAOK2
Protein Name TAO kinase 2
Synonyms MAP3K17|PSK|PSK1|PSK1-BETA|TAO1|TAO2
Ortholog resource in our bank

  TAOK2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011966 IRAK029P06 pCMV-SPORT6 BC031825 NM_016151 Partial/var
HGX042975 IRAK107H07 pCMV-SPORT6 BC051798 NM_016151 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR363302 RBd08E06 pGCAP10 NM_004783.2  
GAGGGAGACCGGGACGAGACCGGGGCTGTGGTGCGGAGAGAGGCTGAGACGGAGAAGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl