Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06950

HP ID(1) HP06950
Gene ID(2) 389941
Gene Symbol finder C1QL3?
Protein Name complement component 1, q subcomponent-like 3
RefSeq NM_001010908.1
Length of RefSeq (bp) 2493
Chromosome 10p13
Reference DDBJ accession
UniGene Hs.676792

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd08D01 pGCAP10 GGGTTCAGCAAGGGAGTATTCAGAATCTCACTGTTCATCCATGTGCAGAGAGAGAAAAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl