Prev. |  KEGG KO K23284 > 

RIKEN DNA Bank Human Resource - C1QL3

Gene ID NCBI Gene 389941 |  KEGG hsa:389941
Gene Symbol C1QL3
Protein Name complement C1q like 3
Synonyms C1QTNF13|C1ql|CTRP13|K100
Ortholog resource in our bank

  C1QL3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR363273 RBd08D01 pGCAP10 NM_001010908.1 done
GGGTTCAGCAAGGGAGTATTCAGAATCTCACTGTTCATCCATGTGCAGAGAGAGAAAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl