Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06928

HP ID(1) HP06928
Gene ID(2) 26128
Gene Symbol finder KIAA1279
Protein Name KIAA1279
RefSeq NM_015634.2
Length of RefSeq (bp) 2542
Chromosome 10q21.3
Reference DDBJ accession
UniGene Hs.279580

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe94C12 pKA1U5 GGAGTCCCGACTGCAAACATTGAGGAAAGCCAGGCAGTAGAGGCCGCTATGGCGAACGTT
RBd27H08 pGCAP10 GGAGGAAAGCCAGGCAGTAGAGGCCGCTATGGCGAACGTTCCGTGGGCAGAGGTCTGCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl