Prev. | 

RIKEN DNA Bank Human Resource - KIF1BP

Gene ID NCBI Gene 26128 |  KEGG hsa:26128
Gene Symbol KIF1BP
Protein Name KIF1 binding protein
Synonyms KBP|KIAA1279|TTC20
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087219 IRAL018A19 pOTB7 BC006427 NM_015634 Full/var
HGY091639 IRAL029B15 pOTB7 BC012180 NM_015634 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100406 M01C051A06 pDONR221 MGC15-B03 BC012180 NM_015634  
HGE100454 M01C051C06 pDONR221 MGC15-B03 BC012180 NM_015634  
HGE100502 M01C051E06 pDONR221 MGC15-B03 BC012180 NM_015634  
HGE100550 M01C051G06 pDONR221 MGC15-B03 BC012180 NM_015634  
HGE100598 M01C051I06 pDONR221 MGC15-B03 BC012180 NM_015634  
HGE100646 M01C051K06 pDONR221 MGC15-B03 BC012180 NM_015634  
HGE100694 M01C051M06 pDONR221 MGC15-B03 BC012180 NM_015634  
HGE100742 M01C051O06 pDONR221 MGC15-B03 BC012180 NM_015634  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR077660 ARe94C12 pKA1U5 NM_015634.2  
GGAGTCCCGACTGCAAACATTGAGGAAAGCCAGGCAGTAGAGGCCGCTATGGCGAACGTT
HKR370976 RBd27H08 pGCAP10 NM_015634.2  
GGAGGAAAGCCAGGCAGTAGAGGCCGCTATGGCGAACGTTCCGTGGGCAGAGGTCTGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl