Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06926

HP ID(1) HP06926
Gene ID(2) 81786
Gene Symbol finder TRIM7
Protein Name tripartite motif-containing 7
RefSeq NM_203293.1
Length of RefSeq (bp) 2862
Chromosome 5q35.3
Reference DDBJ accession
UniGene Hs.487412

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi12G04 pGCAP10 GAGTGGGCCCTCGGCGCCCAGCTCCGCGTCCTGTGAGGTCCAGTGGCCGCCCAGGCGCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl