Prev. |  KEGG KO K12000 > 

RIKEN DNA Bank Human Resource - TRIM7

Gene ID NCBI Gene 81786 |  KEGG hsa:81786
Gene Symbol TRIM7
Protein Name tripartite motif containing 7
Synonyms GNIP|RNF90
Ortholog resource in our bank

  TRIM7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164948 ARi12G04 pGCAP10 NM_203293.1  
GAGTGGGCCCTCGGCGCCCAGCTCCGCGTCCTGTGAGGTCCAGTGGCCGCCCAGGCGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl