Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06922

HP ID(1) HP06922
Gene ID(2) 10618
Gene Symbol finder TGOLN2
Protein Name trans-golgi network protein 2
RefSeq NM_006464.2
Length of RefSeq (bp) 6345
Chromosome 2p11.2
Reference DDBJ accession
UniGene Hs.593382

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi12D03 pGCAP10 GAGGGCGGAAGCGCTATCCGAGCAGGATGCGGTTCGTGGTTGCCTTGGTCCTCCTGAACG
ARi44D03 pGCAP10 GAGAGGGCGGAAGCGCTATCCGAGCAGGATGCGGTTCGTGGTTGCCTTGGTCCTCCTGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl