Prev. | 

RIKEN DNA Bank Human Resource - TGOLN2

Gene ID NCBI Gene 10618 |  KEGG hsa:10618
Gene Symbol TGOLN2
Protein Name trans-golgi network protein 2
Synonyms TGN38|TGN46|TGN48|TGN51|TTGN2|hTGN46|hTGN48|hTGN51
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX016903 IRAK042E07 pCMV-SPORT6 BC035237 NM_006464 Partial/var
HGX025022 IRAK062J06 pCMV-SPORT6 BC028219 NM_006464 Partial
HGX043077 IRAK107L13 pCMV-SPORT6 BC046196 NM_006464 Partial/var
HGY088750 IRAL021O14 pDNR-LIB BC008461 NM_006464 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025211 W01A063A11 pENTR-TOPO IRAL021O14 BC008461 NM_006464  
HGE025215 W01A063A15 pENTR-TOPO IRAL021O14 BC008461 NM_006464  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164875 ARi12D03 pGCAP10 NM_006464.2  
GAGGGCGGAAGCGCTATCCGAGCAGGATGCGGTTCGTGGTTGCCTTGGTCCTCCTGAACG
HKR177675 ARi44D03 pGCAP10 NM_006464.2  
GAGAGGGCGGAAGCGCTATCCGAGCAGGATGCGGTTCGTGGTTGCCTTGGTCCTCCTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl