Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06921

HP ID(1) HP06921
Gene ID(2) 5279
Gene Symbol finder PIGC
Protein Name phosphatidylinositol glycan anchor biosynthesis, class C
RefSeq NM_153747.1
Length of RefSeq (bp) 1537
Chromosome 1q23-q25
Reference DDBJ accession
UniGene Hs.188456

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe94F11 pKA1U5 GGCTTGGCCACAGTCGCAGCCCCGGCGCCCCGAAGCGGGAAAAAGGCTGGGTGCCGCCGT
ARi12B09 pGCAP10 GGCAGCCCCGGCGCCCCGAAGCGGGAAAAAGGCTGGGTGCCGCCGTCCCCCAGCTGCGCA
ARi65B08 pGCAP10 GGCTTGGCCACAGTCGCAGCCCCGGCGCCCCGAAGCGGGAAAAAGGCTGGGTGCCGCCGT
ARiS161D01 pGCAP10 GCCCGGCGCCCCGAAGCGGGAAAAAGGCTGGGTGCCGCCGTCCCCCAGCTGCGCAACCCT
RBd20B09 pGCAP10 GGCAGCCCCGGCGCCCCGAAGCGGGAAAAAGGCTGGGTGCCGCCGTCCCCCAGCTGCGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl