Prev. |  KEGG KO K03859 > 

RIKEN DNA Bank Human Resource - PIGC

Gene ID NCBI Gene 5279 |  KEGG hsa:5279
Gene Symbol PIGC
Protein Name phosphatidylinositol glycan anchor biosynthesis class C
Synonyms GPI2
Ortholog resources KEGG ortholog (KEGG orthology K03859) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081127 IRAL002N15 pOTB7 BC006539 NM_153747 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR077731 ARe94F11 pKA1U5 NM_153747.1  
GGCTTGGCCACAGTCGCAGCCCCGGCGCCCCGAAGCGGGAAAAAGGCTGGGTGCCGCCGT
HKR164833 ARi12B09 pGCAP10 NM_153747.1  
GGCAGCCCCGGCGCCCCGAAGCGGGAAAAAGGCTGGGTGCCGCCGTCCCCCAGCTGCGCA
HKR186032 ARi65B08 pGCAP10 NM_153747.1  
GGCTTGGCCACAGTCGCAGCCCCGGCGCCCCGAAGCGGGAAAAAGGCTGGGTGCCGCCGT
HKR264473 ARiS161D01 pGCAP10 NM_153747.1  
GCCCGGCGCCCCGAAGCGGGAAAAAGGCTGGGTGCCGCCGTCCCCCAGCTGCGCAACCCT
HKR368033 RBd20B09 pGCAP10 NM_153747.1  
GGCAGCCCCGGCGCCCCGAAGCGGGAAAAAGGCTGGGTGCCGCCGTCCCCCAGCTGCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl