Prev. | NRCD Clone J | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06916

HP ID(1) HP06916
Gene ID(2) 122953
Gene Symbol finder JDP2
Protein Name jun dimerization protein 2
RefSeq NM_130469.3
Length of RefSeq (bp) 4007
Chromosome 14q24.3
Reference DDBJ accession
UniGene Hs.196482

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi11B11 pGCAP10 GGCCGCCCGCCACAGCCTGCGGGAGGGACGCTCGGCGGCCGCGACGGGGGGCGCTGGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl