Prev. |  KEGG KO K09033 > 

RIKEN DNA Bank Human Resource - JDP2

Gene ID NCBI Gene 122953 |  KEGG hsa:122953
Gene Symbol JDP2
Protein Name Jun dimerization protein 2
Synonyms JUNDM2
Ortholog resource in our bank

  JDP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06215 pET_HisFLAG-hsJDP2 Expression vector, bacterial, of human JDP2
RDB06216 pET_His-hsJDP2 Expression vector, bacterial, of human JDP2
RDB06250 pCMFlag_hsJDP2 Expression vector of human JDP2.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY098860 IRAL047C12 pOTB7 BC051303 NM_130469

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000654 W01A001K14 pENTR-TOPO IRAL047C12 BC051303 NM_130469  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164435 ARi11B11 pGCAP10 NM_130469.3  
GGCCGCCCGCCACAGCCTGCGGGAGGGACGCTCGGCGGCCGCGACGGGGGGCGCTGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.02

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl