Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06871

HP ID(1) HP06871
Gene ID(2) 388272
Gene Symbol finder C16orf87
Protein Name chromosome 16 open reading frame 87
RefSeq NM_001001436.2
Length of RefSeq (bp) 1410
Chromosome 16q11.2
Reference DDBJ accession
UniGene Hs.406551

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd06G04 pGCAP10 GGCCGTCGCTGCTGCCGCCGCTAAGGGAGAGGAGCATGTCTGCAACTCGAGCCAAGAAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl