Prev. | 

RIKEN DNA Bank Human Resource - C16orf87

Gene ID NCBI Gene 388272 |  KEGG hsa:388272
Gene Symbol C16orf87
Protein Name chromosome 16 open reading frame 87
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY099535 IRAL048N23 pDNR-LIB BC056676 NM_001001436 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE090429 M01C026B05 pDONR221 MGC02-G03 BC056676 NM_001001436  
HGE090477 M01C026D05 pDONR221 MGC02-G03 BC056676 NM_001001436  
HGE090525 M01C026F05 pDONR221 MGC02-G03 BC056676 NM_001001436  
HGE090573 M01C026H05 pDONR221 MGC02-G03 BC056676 NM_001001436  
HGE090621 M01C026J05 pDONR221 MGC02-G03 BC056676 NM_001001436  
HGE090669 M01C026L05 pDONR221 MGC02-G03 BC056676 NM_001001436  
HGE090717 M01C026N05 pDONR221 MGC02-G03 BC056676 NM_001001436  
HGE090765 M01C026P05 pDONR221 MGC02-G03 BC056676 NM_001001436  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR362548 RBd06G04 pGCAP10 NM_001001436.2  
GGCCGTCGCTGCTGCCGCCGCTAAGGGAGAGGAGCATGTCTGCAACTCGAGCCAAGAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl