Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06866

HP ID(1) HP06866
Gene ID(2) 705
Gene Symbol finder BYSL
Protein Name bystin-like
RefSeq NM_004053.3
Length of RefSeq (bp) 2005
Chromosome 6p21.1
Reference DDBJ accession
UniGene Hs.106880

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd06D12 pGCAP10 GGCATCCTGGCCTTTCTTCAGTCCCCACGTGCGATCCTTCCCGGCAACTTTTTCGAGAAA
RBdS007I06 pGCAP10 GGCCTTTCTTCAGTCCCCACGTGCGATCCTTCCCGGCAACTTTTTCGAGAAAAATGCCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl