Prev. |  KEGG KO K14797 > 

RIKEN DNA Bank Human Resource - BYSL

Gene ID NCBI Gene 705 |  KEGG hsa:705
Gene Symbol BYSL
Protein Name bystin like
Synonyms BYSTIN|Enp1
Ortholog resource in our bank

  BYSL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044187 IRAK110H19 pCMV-SPORT6 BC050645 NM_004053 Full
HGX054250 IRAK135K10 pCMV-SPORT6 BC062627 NM_004053 Full
HGY081552 IRAL003O16 pOTB7 BC007340 NM_004053 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR362484 RBd06D12 pGCAP10 NM_004053.3  
GGCATCCTGGCCTTTCTTCAGTCCCCACGTGCGATCCTTCCCGGCAACTTTTTCGAGAAA
HKR402998 RBdS007I06 pGCAP10 NM_004053.3  
GGCCTTTCTTCAGTCCCCACGTGCGATCCTTCCCGGCAACTTTTTCGAGAAAAATGCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl