Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06859

HP ID(1) HP06859
Gene ID(2) 154791
Gene Symbol finder C7orf55
Protein Name chromosome 7 open reading frame 55
RefSeq NM_197964.3
Length of RefSeq (bp) 683
Chromosome 7q34
Reference DDBJ accession
UniGene Hs.714904

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd05D10 pGCAP10 GGTAGGACGCCGTTGGGCACCACGCTCGGAGAAGGACAGGACAATGGCGGCCTTAGGGTC
RBd29C03 pGCAP10 TGGTTTTCAGGGTCGTAGGACGCCGTTGGGCACCACGCTCGGAGAAGGACAGGACAATGG
RBd85A12 pGCAP10 GGAGAAGGACAGGACAATGGCGGCCTTAGGGTCCCCGTCGCACACTTTTCGAGGACTTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl