Prev. | 

RIKEN DNA Bank Human Resource - FMC1

Gene ID NCBI Gene 154791 |  KEGG hsa:154791
Gene Symbol FMC1
Protein Name formation of mitochondrial complex V assembly factor 1 homolog
Synonyms C7orf55|HSPC268
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088756 IRAL021O20 pDNR-LIB BC008467 NM_197964 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096438 M01C041B14 pDONR221 MGC10-D07 BC008467 ENST00000315967  
HGE096486 M01C041D14 pDONR221 MGC10-D07 BC008467 ENST00000315967  
HGE096534 M01C041F14 pDONR221 MGC10-D07 BC008467 ENST00000315967  
HGE096582 M01C041H14 pDONR221 MGC10-D07 BC008467 ENST00000315967  
HGE096630 M01C041J14 pDONR221 MGC10-D07 BC008467 ENST00000315967  
HGE096678 M01C041L14 pDONR221 MGC10-D07 BC008467 ENST00000315967  
HGE096726 M01C041N14 pDONR221 MGC10-D07 BC008467 ENST00000315967  
HGE096774 M01C041P14 pDONR221 MGC10-D07 BC008467 ENST00000315967  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR362082 RBd05D10 pGCAP10 NM_197964.3  
GGTAGGACGCCGTTGGGCACCACGCTCGGAGAAGGACAGGACAATGGCGGCCTTAGGGTC
HKR371651 RBd29C03 pGCAP10 NM_197964.3  
TGGTTTTCAGGGTCGTAGGACGCCGTTGGGCACCACGCTCGGAGAAGGACAGGACAATGG
HKR394012 RBd85A12 pGCAP10 NM_197964.3  
GGAGAAGGACAGGACAATGGCGGCCTTAGGGTCCCCGTCGCACACTTTTCGAGGACTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl