Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06855

HP ID(1) HP06855
Gene ID(2) 5442
Gene Symbol finder POLRMT
Protein Name polymerase (RNA) mitochondrial (DNA directed)
RefSeq NM_005035.3
Length of RefSeq (bp) 3800
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.254113

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd05B04 pGCAP10 GGGCGGCGGCGCCTGGAGCGGCGTGCGTAATGTCGGCACTTTGCTGGGGCCGCGGAGCGG
RBd52B03 pGCAP10 GGCGGGCCGGTGGGGTGGCGGCGGCGGCGGCGGCGGCGCCTGGAGCGGCGTGCGTAATGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl