Prev. |  KEGG KO K10908 > 

RIKEN DNA Bank Human Resource - POLRMT

Gene ID NCBI Gene 5442 |  KEGG hsa:5442
Gene Symbol POLRMT
Protein Name RNA polymerase mitochondrial
Synonyms APOLMT|MTRNAP|MTRPOL|h-mtRPOL
Ortholog resources KEGG ortholog (KEGG orthology K10908) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR362028 RBd05B04 pGCAP10 NM_005035.3  
GGGCGGCGGCGCCTGGAGCGGCGTGCGTAATGTCGGCACTTTGCTGGGGCCGCGGAGCGG
HKR380827 RBd52B03 pGCAP10 NM_005035.3  
GGCGGGCCGGTGGGGTGGCGGCGGCGGCGGCGGCGGCGCCTGGAGCGGCGTGCGTAATGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl