Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06841

HP ID(1) HP06841
Gene ID(2) 55119
Gene Symbol finder PRPF38B
Protein Name PRP38 pre-mRNA processing factor 38 (yeast) domain containing B
RefSeq NM_018061.2
Length of RefSeq (bp) 3711
Chromosome 1p13.3
Reference DDBJ accession
UniGene Hs.342307

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS049D21 pGCAP10 AATGTCCCAGGGGCAGTTGGCGGAAGAGATCGAGCTCCCTGGCTGCCGGCTCGCCTTCTG
RBd04A03 pGCAP10 GAGGGGCAGTTGGCGGAAGAGATCGAGCTCCCTGGCTGCCGGCTCGCCTTCTGCGTGGAG
RBd25A07 pGCAP10 GCCCTCCTTCCTTCCGCCGCAACATGGCTAACAACAGCCCCGCGCTGACAGGCAACTCGC
RBd72G04 pGCAP10 GATCTTGTTCCCAGGGGCAGTTGGCGGAAGAGATCGAGCTCCCTGGCTGCCGGCTCGCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl