Prev. |  KEGG KO K12850 > 

RIKEN DNA Bank Human Resource - PRPF38B

Gene ID NCBI Gene 55119 |  KEGG hsa:55119
Gene Symbol PRPF38B
Protein Name pre-mRNA processing factor 38B
Synonyms NET1
Ortholog resources KEGG ortholog (KEGG orthology K12850) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033921 IRAK084N09 pCMV-SPORT6 BC040127 NM_018061
HGY086932 IRAL017F12 pOTB7 BC007757 NM_018061 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR219693 ARiS049D21 pGCAP10 NM_018061.2  
AATGTCCCAGGGGCAGTTGGCGGAAGAGATCGAGCTCCCTGGCTGCCGGCTCGCCTTCTG
HKR361603 RBd04A03 pGCAP10 NM_018061.2  
GAGGGGCAGTTGGCGGAAGAGATCGAGCTCCCTGGCTGCCGGCTCGCCTTCTGCGTGGAG
HKR370007 RBd25A07 pGCAP10 NM_018061.2  
GCCCTCCTTCCTTCCGCCGCAACATGGCTAACAACAGCCCCGCGCTGACAGGCAACTCGC
HKR388948 RBd72G04 pGCAP10 NM_018061.2  
GATCTTGTTCCCAGGGGCAGTTGGCGGAAGAGATCGAGCTCCCTGGCTGCCGGCTCGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl