Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06840

HP ID(1) HP06840
Gene ID(2) 54495
Gene Symbol finder TXNDC10
Protein Name thioredoxin domain containing 10
RefSeq NM_019022.3
Length of RefSeq (bp) 4767
Chromosome 18q22
Reference DDBJ accession
UniGene Hs.440534

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013N12 pGCAP10 GCCTTTCCGGGCGGGCNNGCGGCGGACCCCAGTGTCTTTATCCCTCTTTTGCACAGTCAG
RBd03H10 pGCAP10 GAGCGCGGTGCTTCTCTTCCGCTCCGGGTCGGCTCCGTTTCCCTTTCCGGGCGGGCAGGC
RBd14H03 pGCAP10 GCCGCTCCGGGTCGGCTCCGTTTCCCTTTCCGGGCGGGCAGGCGGCGGACCCCAGTGTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl