Prev. |  KEGG KO K09585 > 

RIKEN DNA Bank Human Resource - TMX3

Gene ID NCBI Gene 54495 |  KEGG hsa:54495
Gene Symbol TMX3
Protein Name thioredoxin related transmembrane protein 3
Synonyms PDIA13|TXNDC10
Ortholog resource in our bank

  TMX3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086012 IRAL015A12 pOTB7 BC007690 NM_019022 Partial
HGY091368 IRAL028G24 pOTB7 BC018981 NM_019022 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE085623 M01C014A23 pDONR221 FLJ04-E12 AK122715 NM_019022 done
HGE085671 M01C014C23 pDONR221 FLJ04-E12 AK122715 NM_019022  
HGE085719 M01C014E23 pDONR221 FLJ04-E12 AK122715 NM_019022  
HGE085767 M01C014G23 pDONR221 FLJ04-E12 AK122715 NM_019022  
HGE085815 M01C014I23 pDONR221 FLJ04-E12 AK122715 NM_019022  
HGE085863 M01C014K23 pDONR221 FLJ04-E12 AK122715 NM_019022  
HGE085911 M01C014M23 pDONR221 FLJ04-E12 AK122715 NM_019022  
HGE085959 M01C014O23 pDONR221 FLJ04-E12 AK122715 NM_019022  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205524 ARiS013N12 pGCAP10 NM_019022.3  
GCCTTTCCGGGCGGGCNNGCGGCGGACCCCAGTGTCTTTATCCCTCTTTTGCACAGTCAG
HKR361378 RBd03H10 pGCAP10 NM_019022.3  
GAGCGCGGTGCTTCTCTTCCGCTCCGGGTCGGCTCCGTTTCCCTTTCCGGGCGGGCAGGC
HKR365771 RBd14H03 pGCAP10 NM_019022.3  
GCCGCTCCGGGTCGGCTCCGTTTCCCTTTCCGGGCGGGCAGGCGGCGGACCCCAGTGTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl