Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06828

HP ID(1) HP06828
Gene ID(2) 375757
Gene Symbol finder C9orf119
Protein Name chromosome 9 open reading frame 119
RefSeq NM_001040011.1
Length of RefSeq (bp) 1004
Chromosome 9q34.11
Reference DDBJ accession
UniGene Hs.259594

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi37F07 pGCAP10 GGCGCGCGCAGCTTTCTGTGCGCCAGTTCACACTCCGGGTCAGAGTTCCTGGCCCGGTGC
RBd02G12 pGCAP10 GACTCCGGGTCAGAGTTCCTGGCCCGGTGCACCTGAGAGGTCGCTCTCCGACTCCCGCGC
RBd90H06 pGCAP10 GACACTCCGGGTCAGAGTTCCTGGCCCGGTGCACCTGAGAGGTCGCTCTCCGACTCCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl