Prev. | 

RIKEN DNA Bank Human Resource - SWI5

Gene ID NCBI Gene 375757 |  KEGG hsa:375757
Gene Symbol SWI5
Protein Name SWI5 homologous recombination repair protein
Synonyms C9orf119|SAE3
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX020440 IRAK051B16 pCMV-SPORT6 BC029911 XM_937771 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR174927 ARi37F07 pGCAP10 NM_001040011.1  
GGCGCGCGCAGCTTTCTGTGCGCCAGTTCACACTCCGGGTCAGAGTTCCTGGCCCGGTGC
HKR360956 RBd02G12 pGCAP10 NM_001040011.1  
GACTCCGGGTCAGAGTTCCTGGCCCGGTGCACCTGAGAGGTCGCTCTCCGACTCCCGCGC
HKR396174 RBd90H06 pGCAP10 NM_001040011.1  
GACACTCCGGGTCAGAGTTCCTGGCCCGGTGCACCTGAGAGGTCGCTCTCCGACTCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl