Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06820

HP ID(1) HP06820
Gene ID(2) 8408
Gene Symbol finder ULK1
Protein Name unc-51-like kinase 1 (C. elegans)
RefSeq NM_003565.1
Length of RefSeq (bp) 5228
Chromosome 12q24.3
Reference DDBJ accession
UniGene Hs.47061

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd02D11 pGCAP10 GGCGGGCGTCTCAGGCTCTGAGGCCCGGGCGCCGCGGCTCTTTTGTTTCTCCGTTGGGGC
RBd18B12 pGCAP10 GTCCCCGCCGGTGTCCGAGAGGCGCCCCCGGCCCGGCCCGGCCCGGCCCGCGCCCTCCGC
RBdS132F18 pGCAP10 GGGNCNTNNCAGGCTCTGAGGCCCGGGCGCCGCGGCTCTTTTGTTTCTCCGTTGGGGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl