Prev. |  KEGG KO K21357 > 

RIKEN DNA Bank Human Resource - ULK1

Gene ID NCBI Gene 8408 |  KEGG hsa:8408
Gene Symbol ULK1
Protein Name unc-51 like autophagy activating kinase 1
Synonyms ATG1|ATG1A|UNC51|Unc51.1|hATG1
Featured content Autophagy (human)
Featured content Mitophagy - human
Ortholog resource in our bank

  ULK1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR360883 RBd02D11 pGCAP10 NM_003565.1  
GGCGGGCGTCTCAGGCTCTGAGGCCCGGGCGCCGCGGCTCTTTTGTTTCTCCGTTGGGGC
HKR367236 RBd18B12 pGCAP10 NM_003565.1  
GTCCCCGCCGGTGTCCGAGAGGCGCCCCCGGCCCGGCCCGGCCCGGCCCGCGCCCTCCGC
HKR452938 RBdS132F18 pGCAP10 NM_003565.1  
GGGNCNTNNCAGGCTCTGAGGCCCGGGCGCCGCGGCTCTTTTGTTTCTCCGTTGGGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl