Prev. | Human A to Z list > U > 

RIKEN DNA Bank Human Resource - ULK1

Gene ID (NCBI) 8408
Gene Symbol ULK1
Protein Name unc-51 like autophagy activating kinase 1
Synonyms ATG1|ATG1A|UNC51|Unc51.1|hATG1
Databases KEGG hsa:8408 |  NCBI Gene 8408
Featured content Autophagy (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K21357)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR360883 RBd02D11 pGCAP10 NM_003565.1  
GGCGGGCGTCTCAGGCTCTGAGGCCCGGGCGCCGCGGCTCTTTTGTTTCTCCGTTGGGGC
HKR367236 RBd18B12 pGCAP10 NM_003565.1  
GTCCCCGCCGGTGTCCGAGAGGCGCCCCCGGCCCGGCCCGGCCCGGCCCGCGCCCTCCGC
HKR452938 RBdS132F18 pGCAP10 NM_003565.1  
GGGNCNTNNCAGGCTCTGAGGCCCGGGCGCCGCGGCTCTTTTGTTTCTCCGTTGGGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl