Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06819

HP ID(1) HP06819
Gene ID(2) 4901
Gene Symbol finder NRL
Protein Name neural retina leucine zipper
RefSeq NM_006177.3
Length of RefSeq (bp) 1974
Chromosome 14q11.2
Reference DDBJ accession
UniGene Hs.652297

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd02D05 pGCAP10 AB593101 TGAGGGAAACGCAGCGCGTTGGAGGGTTGGGGGCTGTCTGGGTGCGGGTCCACTGGACAC
RBd06E01 pGCAP10 AB593102 AGTCAGCCCCCTGGAGCTGAGCAGAGGCACCAGGCCCTGCTCCATGGAGCCTTCAGTCTC
RBd23F08 pGCAP10 AB593103 GAGGGAAACGCAGCGCGTTGGAGGGTTGGGGGCTGTCTGGGTGCGGGTCCACTGGACACA
RBd29E02 pGCAP10 AB593104 GAGCCCCCTGGAGCTGAGCAGAGGCACCAGGCCCTGCTCCATGGAGCCTTCAGTCTCCTG
RBdS104O14 pGCAP10 GAGGCTTCAGGACAGGGAAACGCAGCGCGTTGGAGGGTTGGGGGCTGTCTGGGTGCGGGT
RBdS154K17 pGCAP10 GAGCCCCCTGGAGCTGAGCAGAGGCACCAGGCCCTGCTCCATGGAGCCTTCAGTCTCCTG
RBdS156L24 pGCAP10 GAGCCCCCTGGAGCTGAGCAGAGGCACCAGGCCCTGCTCCATGGAGCCTTCAGTCTCCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl