Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NRL

Gene ID (NCBI) 4901
Gene Symbol NRL
Protein Name neural retina leucine zipper
Synonyms D14S46E|NRL-MAF|RP27
Databases KEGG link 01 |  NCBI Gene link 01


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06266 pCMFlag_hsNRL Expression vector of human NRL

RDB_hum_160722.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008681 IRAK021L17 pCMV-SPORT6 BC012395 NM_006177 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE000919 W01A002E23 pENTR-TOPO IRAK021L17 BC012395 NM_006177

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR360877 RBd02D05 pGCAP10 NM_006177.3
TGAGGGAAACGCAGCGCGTTGGAGGGTTGGGGGCTGTCTGGGTGCGGGTCCACTGGACAC
HKR362497 RBd06E01 pGCAP10 NM_006177.3
AGTCAGCCCCCTGGAGCTGAGCAGAGGCACCAGGCCCTGCTCCATGGAGCCTTCAGTCTC
HKR369328 RBd23F08 pGCAP10 NM_006177.3
GAGGGAAACGCAGCGCGTTGGAGGGTTGGGGGCTGTCTGGGTGCGGGTCCACTGGACACA
HKR371698 RBd29E02 pGCAP10 NM_006177.3
GAGCCCCCTGGAGCTGAGCAGAGGCACCAGGCCCTGCTCCATGGAGCCTTCAGTCTCCTG
HKR441950 RBdS104O14 pGCAP10 NM_006177.3
GAGGCTTCAGGACAGGGAAACGCAGCGCGTTGGAGGGTTGGGGGCTGTCTGGGTGCGGGT
HKR461857 RBdS154K17 pGCAP10 NM_006177.3
GAGCCCCCTGGAGCTGAGCAGAGGCACCAGGCCCTGCTCCATGGAGCCTTCAGTCTCCTG
HKR462688 RBdS156L24 pGCAP10 NM_006177.3
GAGCCCCCTGGAGCTGAGCAGAGGCACCAGGCCCTGCTCCATGGAGCCTTCAGTCTCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl