Prev. |  KEGG KO K09038 > 

RIKEN DNA Bank Human Resource - NRL

Gene ID NCBI Gene 4901 |  KEGG hsa:4901
Gene Symbol NRL
Protein Name neural retina leucine zipper
Synonyms D14S46E|NRL-MAF|RP27
Ortholog resource in our bank

  NRL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06266 pCMFlag_hsNRL Expression vector of human NRL.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008681 IRAK021L17 pCMV-SPORT6 BC012395 NM_006177 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000919 W01A002E23 pENTR-TOPO IRAK021L17 BC012395 NM_006177  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR360877 RBd02D05 pGCAP10 NM_006177.3  
TGAGGGAAACGCAGCGCGTTGGAGGGTTGGGGGCTGTCTGGGTGCGGGTCCACTGGACAC
HKR362497 RBd06E01 pGCAP10 NM_006177.5 full cds  
AGTCAGCCCCCTGGAGCTGAGCAGAGGCACCAGGCCCTGCTCCATGGAGCCTTCAGTCTC
HKR369328 RBd23F08 pGCAP10 NM_006177.3  
GAGGGAAACGCAGCGCGTTGGAGGGTTGGGGGCTGTCTGGGTGCGGGTCCACTGGACACA
HKR371698 RBd29E02 pGCAP10 NM_006177.5 full cds  
GAGCCCCCTGGAGCTGAGCAGAGGCACCAGGCCCTGCTCCATGGAGCCTTCAGTCTCCTG
HKR461857 RBdS154K17 pGCAP10 NM_006177.5 full cds  
GAGCCCCCTGGAGCTGAGCAGAGGCACCAGGCCCTGCTCCATGGAGCCTTCAGTCTCCTG
HKR441950 RBdS104O14 pGCAP10 NM_006177.3  
GAGGCTTCAGGACAGGGAAACGCAGCGCGTTGGAGGGTTGGGGGCTGTCTGGGTGCGGGT
HKR462688 RBdS156L24 pGCAP10 NM_006177.5 full cds  
GAGCCCCCTGGAGCTGAGCAGAGGCACCAGGCCCTGCTCCATGGAGCCTTCAGTCTCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl