Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06816

HP ID(1) HP06816
Gene ID(2) 64222
Gene Symbol finder TOR3A
Protein Name torsin family 3, member A?
RefSeq NM_022371.3
Length of RefSeq (bp) 2138
Chromosome 1q25.2
Reference DDBJ accession
UniGene Hs.584957

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd01H12 pGCAP10 GGCCTAGGAAGTGCGGTCCCCGCCTGACCGCCCCGGGCTTAAGGGAGCCTGGCTAGGCCG
RBd63F06 pGCAP10 GGTCAGTCTCGGGACTGCCTCTCAGGACCCCAGACAGGGTTTCGGGTTCCCGCCTGGGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl