Prev. | 

RIKEN DNA Bank Human Resource - TOR3A

Gene ID NCBI Gene 64222 |  KEGG hsa:64222
Gene Symbol TOR3A
Protein Name torsin family 3 member A
Synonyms ADIR|ADIR2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007967 IRAK019P07 pCMV-SPORT6 BC018292 NM_022371 Full/var
HGY090840 IRAL027B16 pOTB7 BC011746 NM_022371 Full
HGY088929 IRAL022F09 pOTB7 BC007571 NM_022371 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR360580 RBd01H12 pGCAP10 NM_022371.3  
GGCCTAGGAAGTGCGGTCCCCGCCTGACCGCCCCGGGCTTAAGGGAGCCTGGCTAGGCCG
HKR385326 RBd63F06 pGCAP10 NM_022371.3  
GGTCAGTCTCGGGACTGCCTCTCAGGACCCCAGACAGGGTTTCGGGTTCCCGCCTGGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl