Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06812

HP ID(1) HP06812
Gene ID(2) 23612
Gene Symbol finder PHLDA3
Protein Name pleckstrin homology-like domain, family A, member 3
RefSeq NM_012396.3
Length of RefSeq (bp) 1516
Chromosome 1q31
Reference DDBJ accession
UniGene Hs.268557

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi47F10 pGCAP10 GGACAGAGCCCAGGGGAGCAAGAGAACGGGCGGGCGGTGGGGCTCACGGCCTAGGGAGGC
ARi59F03 pGCAP10 GAGGGTAGGAATGCGCTGCGGGCGGGCGGCGCAGGAGGCGAGCGGCGGAACATGTAAGGG
ARiS020P15 pGCAP10 GGCACATCCCGCGAGCTGCCGCCCAGCGCGCAGACAGAGCCCAGGGGAGCAAGAGAACGG
ARiS161B13 pGCAP10 GAGGCNNNNNNCNGAACATGTAAGGGCACATCCCGCGAGCTGCCGCCCAGCGCGCANACA
RBd01F12 pGCAP10 GGCGCTGCGGGCGGGCGGCGCAGGAGGCGAGCGGCGGAACATGTAAGGGCACATCCCGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl