Prev. | 

RIKEN DNA Bank Human Resource - PHLDA3

Gene ID NCBI Gene 23612 |  KEGG hsa:23612
Gene Symbol PHLDA3
Protein Name pleckstrin homology like domain family A member 3
Synonyms TIH1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020720 IRAK051N08 pCMV-SPORT6 BC068273 NM_012396 Full
HGY083578 IRAL008P18 pOTB7 BC014390 NM_012396 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178930 ARi47F10 pGCAP10 NM_012396.3  
GGACAGAGCCCAGGGGAGCAAGAGAACGGGCGGGCGGTGGGGCTCACGGCCTAGGGAGGC
HKR183723 ARi59F03 pGCAP10 NM_012396.3  
GAGGGTAGGAATGCGCTGCGGGCGGGCGGCGCAGGAGGCGAGCGGCGGAACATGTAAGGG
HKR208375 ARiS020P15 pGCAP10 NM_012396.3  
GGCACATCCCGCGAGCTGCCGCCCAGCGCGCAGACAGAGCCCAGGGGAGCAAGAGAACGG
HKR264437 ARiS161B13 pGCAP10 NM_012396.3  
GAGGCNNNNNNCNGAACATGTAAGGGCACATCCCGCGAGCTGCCGCCCAGCGCGCANACA
HKR360532 RBd01F12 pGCAP10 NM_012396.3  
GGCGCTGCGGGCGGGCGGCGCAGGAGGCGAGCGGCGGAACATGTAAGGGCACATCCCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl