Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06806

HP ID(1) HP06806
Gene ID(2) 56965
Gene Symbol finder PARP6
Protein Name poly (ADP-ribose) polymerase family, member 6
RefSeq NM_020214.2
Length of RefSeq (bp) 2631
Chromosome 15q23
Reference DDBJ accession
UniGene Hs.270244

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS118F23 pGCAP10 GCCCGGGCCGCTCGTCCCGTCGGCTGCGGCCGCGCGCGGCCCGGGGTCGCCGTGAGTACT
RBd01C01 pGCAP10 TTGCCCTACCTTGTCTCCCTTTGTGGTCTCCTAAATGCCCATCTCGTTGGCCTTGGTTCG
RBd97E03 pGCAP10 GGGGGGAGCGCGCCCGTGACGGAACGACGAGGCGTGGGGTGCGCGACCTCGCCCGCCAGG
RBdS081M23 pGCAP10

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl